Home   Site Map   How to Cite   Help   Contact
 
m6A Prediction Tool in Maize

RNA N6-methyladenosine (m6A) has been reported to control diverse genetic information and metabolic switches including RNA decay, translation efficiency, nuclear retention, and splicing. Transcriptome-wide profile of m6A has been revealed in maize. In our SMEP, users could easily enquiry and predict the potential m6A site on targeted DNA regions.

 

Type/Paste the gene sequence with FASTA format below:
 
  Select modification type:  
   

Example:

>test

ATTGACGGGTTAATGTGAGCTTATCCATGCGGTTAGGCACTCTTCAAATAGGAATCCATTTTCTAACTGGCTTTTTATCAGTAACCTTCTATGGCTAAATATTTGTATGTTGACTTTCCTTCTATCCATCCATCCACAGGAGCGAAGGTAAAGGTTGAGTGCAGATCGAAATCCACTGGCGCCAAGACATGCAGCTTCGAGGGCCAGACTGACCACACTGGCACCTACAACATCCCTGTCAACGATGAGCATGAGCACGAGCTCTGCGAGTCTGTCCTTGTGAGCAGCCCGGACGCAAAGTGTGGCAAGATTGTTGCTGGACGGGAGAGGGCTCCTGTCTTCCTCACCAACAACAATGGTGTGACATCTAATGTTCGGTTGGCGAACGCTCTGGGCTTCCAGAAGGATGCTCCTCTTGCTGCGTGCGCACAAATCCTCAAGATGTACGAGGAAGTGGACGACCGCGTTTGAAGGATGTGAGTTATGTATCAATATTCGTACGTTGTTGAAATACTCTAAGAAGACTTCTATATACCTTTTACTGAGAGCAAAACTATCAGCATCAGATGTTGCGTGCTTGATAAGTTGTGATATAGCTTA

Results

 
 

Welcome to eLab in CAAS
eLab located at Biotechnology Research Institute, Chinese Academy of Agricultural sciences, 12 Zhongguancun South Street, Beijing, China.

 
 
Copyright©2018 eLAbcaas.cn All rights reserved. Design by eLAbcaas.cn.