Home   Site Map   How to Cite   Help   Contact
 
Help

DNA methylation, RNA methylation, and histone modification

 

In these pages, DNA 6mA and 5mC, RNA m6A, and histone modification (H3K4me3, H3K27me3 and H3K9ac) can be searched. In the prediction tool, you need to input a sequence of 1-100000bp fasta format.

 

Refer to the example below:

>test

CCGGAGAGACAACGGGATCCAGGCGCCAGCGACGGATCCGGGATCTGCCGCCCACGACCCGAGTCATCGTTGGATCCACCACGTTGCCACTAGAGAAAAAGGAGGCGAGAGCGAGGGCAAAACGGAAGAATAAGTTGAGGGAGAGGGGACAGCCGAATCTGCGGATGCGGATGATATTTTTATTATAGACTAGAGATGATTATTGTGATGAAAAGGAGAGCAGTAAGAGAGCAGTAAGAGCATCCCTCCTCACTCCATCCTCAACTACCCACTT

 

For searching of each epigenetic mark, please choose reference genome Nipponbare (Nip) or 93-11 and entry the fasta sequence.

 

 Example results:

 

 
 

Welcome to eLab in CAAS
eLab located at Biotechnology Research Institute, Chinese Academy of Agricultural sciences, 12 Zhongguancun South Street, Beijing, China.

 
 
Copyright©2018 eLAbcaas.cn All rights reserved. Design by eLAbcaas.cn.