Home   Site Map   How to Cite   Help   Contact
 
H3K4me3 AI Prediction Tool in Maize

Covalent histone modifications, including histone H3K4me3, H3K27me3 and H3K9ac, play an essential role in the regulation of gene expression in plants. In this SMEP, users could easily enquiry and predict histone mark sites on targeted DNA regions.

 

Type/Paste the gene sequence with FASTA format below:
 
  Select modification type:  
   

Example:

>test

TGGTTTTGTGTGTTCATGTGTAGTTAATTTAGTTTATGTGTGTAATGTTGCAGGGCTGAAGAGGTGTGGCAAGAGCTGCAGGCTAAGGTGGCTGAATTACCTGAGGCCAAACATAAAGCATGGGGACTTCACCCCAGAGGAGGACAGCATCATCTGCAGCCTCTACATTAGCATAGGGAGCAGGTACATAATTACACCACTAACCACTCTCCCTTCTCACTAACTATCAATCAATCATCATAATCACACTAAACTTGACATAATTAACCACAGGTGGTCAATCATAGCAGCACAGCTGCCAGGGAGGACGGACAACGATGTCAAGAACTACTGGAACACAAAGCTGAAGAAGAGACTCCTTGGCCGGCGCAAGGACCGCGGCGGCGGCCACCACCACCGCAGCCAGAGCACCGCCGACGATCTTCCGGCCGGTGGTGACGGCGGCATGAACGACGGCGGCGGCGGCGGCGGAGAGCGGTCGCTGAGCGCGTCGGCGATGGAGAGGATCCAGCTCTGCATGCAGCTGCAGGAGCTGCAGAACCCACTGTCCATCCACCACAACCCCTTGCTCTCTCATCAGTGGCCAAGCAAGGCCACCATTGATGATCAGAATCACAACAATGTCACTGTGGCTGAACATGGAATGTCAAGCTCTGTGAGCGACCACCACCGCCTCGATGGGCAGCAGCTGGAGAGCGGCGCCGGCGCCGCCGCCATGCAGCAGGCGTCGCCGTCGAGCGGCGGCGAGAACTCCAACGTCGTCGTCGCCATCGAGGCCGAGCTCCAGGAGCTTCTCTACG

Results

 
 

Welcome to eLab in CAAS
eLab located at Biotechnology Research Institute, Chinese Academy of Agricultural sciences, 12 Zhongguancun South Street, Beijing, China.

 
 
Copyright©2018 eLAbcaas.cn All rights reserved. Design by eLAbcaas.cn.