![]() |
|
|||
| 5mC Prediction Tool in Maize | |||||
DNA 5mC has significant role in regulating gene expression and TE silencing in plants. 5mC has been located in all sequence contexts such as, CG, CHG and CHH (where H= A, T or C). In this SMEP, users could easily enquiry and predict the potential 5mC sites on targeted DNA regions.
|
|||||
| Type/Paste the gene sequence with FASTA format below: | |||||
|
Example: >test CCGGAGAGACAACGGGATCCAGGCGCCAGCGACGGATCCGGGATCTGCCGCCCACGACCCGAGTCATCGTTGGATCCACCACGTTGCCACTAGAGAATCTACCTGACATCCATTAGCTTTGATCCAAGAAAAAATTTGTAACAGGTATAAAATCACATCTTCATTAAAGTCAGCAGCCCACATCATCTCCAGGGCTGTTTTTCCCTCTAGCAAAAAGAACAGGTGCCAG Results |
|||||
Welcome to eLab in CAAS |
Copyright©2018 eLAbcaas.cn All rights reserved. Design by eLAbcaas.cn.
|