Home   Site Map   How to Cite   Help   Contact
 
5mC Prediction Tool in Rice

DNA 5mC has significant role in regulating gene expression and TE silencing in plants. 5mC has been located in all sequence contexts such as, CG, CHG and CHH (where H= A, T or C). In this SMEP, users could easily enquiry and predict the potential 5mC sites on targeted DNA regions.

 

Type/Pater the gene sequence with the Fasta format below:
 
  Select modification type:  
   

Example:

>test

CCGGAGAGACAACGGGATCCAGGCGCCAGCGACGGATCCGGGATCTGCCGCCCACGACCCGAGTCATCGTTGGATCCACCACGTTGCCACTAGAGAATCTACCTGACATCCATTAGCTTTGATCCAAGAAAAAATTTGTAACAGGTATAAAATCACATCTTCATTAAAGTCAGCAGCCCACATCATCTCCAGGGCTGTTTTTCCCTCTAGCAAAAAGAACAGGTGCCAG

Results

 
 

Welcome to eLab in CAAS
eLab located at Biotechnology Research Institute, Chinese Academy of Agricultural sciences, 12 Zhongguancun South Street, Beijing, China.

 
 
Copyright©2018 eLAbcaas.cn All rights reserved. Design by eLAbcaas.cn.