Home   Site Map   How to Cite   Help   Contact
 
6mA Prediction Tool in Arabidopsis thaliana

DNA 6mA is a new discovery of DNA modifications in plants and characterization of 6mA in Arabidopsis thaliana and rice have revealed its potential regulatory functions in all plant kingdom. In this SMEP, users could easily enquiry and predict the potential 6mA sites on targeted DNA regions.

 

Type/Pater the gene sequence with the Fasta format below:
 
  Select modification type:  
   

Example:

>test

CCGGAGAGACAACGGGATCCAGGCGCCAGCGACGGATCCGGGATCTGCCGCCCACGACCCGAGTCATCGTTGGATCCACCACGTTGCCACTAGAGAAAAAGGAGGCGAGAGCGAGGGCAAAACGGAAGAATAAGTTGAGGGAGAGGGGACAGCCGAATCTGCGGATGCGGATGATATTTCCACCACGTTGCCTCCACCACGTTGCCTTTATTATAGACTAGAGATGATTATTGTGAGAGAGCAGTAAGAGAGCAGTAAGAGCATCCCTCCTCACTCCATCCTCAACTACCCACTTCCCAAGATTTAGCAT

Results

 
 

Welcome to eLab in CAAS
eLab located at Biotechnology Research Institute, Chinese Academy of Agricultural sciences, 12 Zhongguancun South Street, Beijing, China.

 
 
Copyright©2018 eLAbcaas.cn All rights reserved. Design by eLAbcaas.cn.