DNA 6mA is a new discovery of DNA modifications in plants and characterization of 6mA in Arabidopsis thaliana and rice have revealed its potential regulatory functions in all plant kingdom. In this SMEP, users could easily enquiry and predict the potential 6mA sites on targeted DNA regions.

Example:

>test

CCGGAGAGACAACGGGATCCAGGCGCCAGCGACGGATCCGGGATCTGCCGCCCACGACCCGAGTCATCGTTGGATCCACCACGTTGCCACTAGAGAAAAAGGAGGCGAGAGCGAGGGCAAAACGGAAGAATAAGTTGAGGGAGAGGGGACAGCCGAATCTGCGGATGCGGATGATATTTCCACCACGTTGCCTCCACCACGTTGCCTTTATTATAGACTAGAGATGATTATTGTGAGAGAGCAGTAAGAGAGCAGTAAGAGCATCCCTCCTCACTCCATCCTCAACTACCCACTTCCCAAGATTTAGCAT

Welcome to eLab in CAAS
eLab located at Biotechnology Research Institute, Chinese Academy of Agricultural sciences, 12 Zhongguancun South Street, Beijing, China.