Home   Site Map   How to Cite   Help   Contact
 

HOME

DNA methylation

5mC in Rice

5mC in Maize

6mA in Rice

6mA in Arabidopsis

RNA methylation

m6A in Rice

m6A in Maize

Histone modification

H3K4me3 in Rice

H3K27me3 in Rice

H3K9ac in Rice

H3K4me3 in Maize

Genome JBrowse

Oryza sativa Japonica group cultivar Nip

Zea mays cultivar B73

Download
6mA Prediction Tool in Rice

DNA 6mA is a new discovery of DNA modifications in plants and characterization of 6mA in Arabidopsis thaliana and rice have revealed its potential regulatory functions in all plant kingdom. In this SMEP, users could easily enquiry and predict the potential 6mA sites on targeted DNA regions.

 
Type/Paste the gene sequence with FASTA format below:
 
  Select modification type:  
   

Example:

>test

CCGGAGAGACAACGGGATCCAGGCGCCAGCGACGGATCCGGGATCTGCCGCCCACGACCCGAGTCATCGTTGGATCCACCACGTTGCCACTAGAGAAAAAGGAGGCGAGAGCGAGGGCAAAACGGAAGAATAAGTTGAGGGAGAGGGGACAGCCGAATCTGCGGATGCGGATGATATTTCCACCACGTTGCCTCCACCACGTTGCCTTTATTATAGACTAGAGATGATTATTGTGAGAGAGCAGTAAGAGAGCAGTAAGAGCATCCCTCCTCACTCCATCCTCAACTACCCACTTCCCAAGATTTAGCAT

Results
 
 

Welcome to eLab in CAAS
eLab located at Biotechnology Research Institute, Chinese Academy of Agricultural sciences, 12 Zhongguancun South Street, Beijing, China.

 
 
Copyright©2018 eLAbcaas.cn All rights reserved. Design by eLAbcaas.cn.