1. Gene Annotation

  Choose your desired rice genomes (i.e. Nip or 9311), Input "locus" or "keyword" and then Click on the "Search" label, you can search gene information and methylation site of 6mA and 5mC.

  For locus searching, please entry the locus identifier (e.g. LOC_Os10g07270)

  For keyword searching, please entry the keyword (e.g. demethylase)

The gene details page shows the location of the gene location and function, 6mA methylation, 5mC methylation, genomic structure (CDS, exons and introns), and protein sequence information.

2. BLAST

  As a fast and basic local alignment search tool, in the functional genome database is indispensable for blasting. You can click on Basic search after input or upload the sequences with comparison of the reference species including NIP genome, NIP CDS, 9311 genome and 9311 CDS databases.

example BLAST results based on 93-11_6mA

example BLAST results based on NIP_5mC

3. Genome JBrowse

  As powerful genomic data visualization tool, we run JBrowse in the NIP and 9311 genomic structure, you could choose different tracks to obtain the region of the different genomic content and methylation levels. We also added other information such as 6mA methylation site, 5mC methylation site and RNA expression.

4. Methylation Analysis

  This website firstly provides 6mA DNA methylation as well as 5mC at a single-nucleotide resolution in Nip and 93-11 associated with actively expressed genes in rice. Based on the information of the two genomes, you can choose the reference genome (Nip or 9311), chromosomes and position regions by clicking on the search label.

5. 6mA AI predictor

In the 6mA prediction tool, you need to input a sequence of 1-100000bp fasta format.Refer to the example below.

Example:

>test

CCGGAGAGACAACGGGATCCAGGCGCCAGCGACGGATCCGGGATCTGCCGCCCACGACCCGAGTCATCGTTGGATCCACCACGTTGCCACTAGAGAAAAAGGAGGCGAGAGCGAGGGCAAAACGGAAGAATAAGTTGAGGGAGAGGGGACAGCCGAATCTGCGGATGCGGATGATATTTTTATTATAGACTAGAGATGATTATTGTGATGAAAAGGAGAGCAGTAAGAGAGCAGTAAGAGCATCCCTCCTCACTCCATCCTCAACTACCCACTTCCCAAGATTTTTTTTAGCATATGTATATCCTGTACCGCTCAGTTGTACTGCTGCGCTACCCCATTGTGCAGCCTATGCAGCATCTAGCCTCGTGTACAATTCCAGATGGAAAACAAGGCGTCAGTTTTGCAATTCTGGCCATATCTTGGAAAAAAAAGGCATCAGATTTTAGTTTAATAGTTTCCTCCTATACTCTGAGGTACTACTCAAGGCATAGCATCCTTATATATTGGAATGGAGGGAGTACTACATAACTGTAATCTTTATATTTTGGAAAGGAGGGAGTAGGTATTAATTTGTTATTTTGGAAAGGAGGGAGTAGGTATTAATTTGTTTGTTTTTAGAGGTAAATGAAAGACTGAGATTCTAGATATTGCATACATGTTCACAAACCCATTATCCATTCACTAGCAGGTGCTGGACTGTGCGATGGCATTTCACGGAATTCGCATTCATCAGCAACATGCGAATTCCGTGAAATGCCATCGCACAAGTGTTTTTACCTGACATCCATTAGCTTTGATCCAACAGCGTAAGCAAGCTTTCGCTGCCCACACCATCAGTTGAGAAAAAATTTGTAACAGGTATAAAATCACATCTTCATTAAAGTCAGCAGCCCACATCATCTCCAGGGCTGTTTTTCCCTCTAGCAAAAAGAACAGGTGCCAG

Complete results

Partial results

Welcome to eLab in CAAS
eLab located at Biotechnology Research Institute, Chinese Academy of Agricultural sciences, 12 Zhongguancun South Street, Beijing, China.